Tehdyt toimenpiteet
|
vectorstrip |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Removes vectors from the ends of nucleotide sequence(s)Description
vectorstrip reads one or more nucleotide sequences and writes them out again but with any of a specified set of vector sequences removed from the 5' and 3' termini. An output file with a summary of the results is also written. The vector sequences to strip out are (typically) provided in an input file. The pair of 5' and 3' vector sequences are searched against each input sequence allowing a specified maximum level of mismatches. Each 5' hit is paired with each 3' hit and the resulting subsequences output. By default only the best match between the vector patterns and each sequence are reported. Optionally, all matches up to the specified maximum mismatch level are reported.
Usage
Here is a sample session with vectorstrip
% vectorstrip @vecseqs.list Removes vectors from the ends of nucleotide sequence(s) Are your vector sequences in a file? [Y]: Cloning vector definition file (optional): vectors Max allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]: vector.strip output sequence(s) [pbluescript.fasta]: vector.fasta |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Removes vectors from the ends of nucleotide sequence(s)
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers (* if not always prompted):
[-sequence] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
[-[no]readfile] toggle [Y] Are your vector sequences in a file?
* -vectorsfile infile Cloning vector definition file (optional)
-mismatch integer [10] Max allowed % mismatch (Any integer
value)
-[no]besthits boolean [Y] Show only the best hits (minimise
mismatches)?
* -alinker string The 5' sequence (Any string)
* -blinker string The 3' sequence (Any string)
[-outfile] outfile [*.vectorstrip] Output file name
[-outseq] seqoutall [
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-[no]readfile] (Parameter 2) |
toggle | Are your vector sequences in a file? | Toggle value Yes/No | Yes |
| -vectorsfile | infile | Cloning vector definition file (optional) | Input file | Required |
| -mismatch | integer | Max allowed % mismatch | Any integer value | 10 |
| -[no]besthits | boolean | Show only the best hits (minimise mismatches)? | Boolean value Yes/No | Yes |
| -alinker | string | The 5' sequence | Any string | |
| -blinker | string | The 3' sequence | Any string | |
| [-outfile] (Parameter 3) |
outfile | Output file name | Output file | <*>.vectorstrip |
| [-outseq] (Parameter 4) |
seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format |
| Additional (Optional) qualifiers | ||||
| -allsequences | boolean | Show all sequences in output | Boolean value Yes/No | No |
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-outfile" associated outfile qualifiers | ||||
| -odirectory3 -odirectory_outfile |
string | Output directory | Any string | |
| "-outseq" associated seqoutall qualifiers | ||||
| -osformat4 -osformat_outseq |
string | Output seq format | Any string | |
| -osextension4 -osextension_outseq |
string | File name extension | Any string | |
| -osname4 -osname_outseq |
string | Base file name | Any string | |
| -osdirectory4 -osdirectory_outseq |
string | Output directory | Any string | |
| -osdbname4 -osdbname_outseq |
string | Database name to add | Any string | |
| -ossingle4 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
| -oufo4 -oufo_outseq |
string | UFO features | Any string | |
| -offormat4 -offormat_outseq |
string | Features format | Any string | |
| -ofname4 -ofname_outseq |
string | Features file name | Any string | |
| -ofdirectory4 -ofdirectory_outseq |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
Input file format
Input files for usage example
File: vecseqs.list
../../data/bluescript.seq ../../data/litmus.seq ../../data/pTYB1.seq |
File: vectors
# Example vector file for use by vectorstrip # Vector 5' 3' pTYB1 GACGGCGGCCGCGAATTCC TCGAGGGCTCTTCCTGC pBS_KS+ GGGTACCGGGCCCCCCC TCGAGGTCGACGGTA pLITMUS GATATCCTGCAGGAATTCC TCGAGACCGTACGTGCG |
The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen.
Each line of the vector file should contain the name of the vector, the
5' pattern and the 3' pattern.
Lines beginning with # are treated as comments and ignored.
If only one vector sequence is given in the it will be assumed that
this is the 5' pattern.
If a vector name is given but no pattern data, the vector will not
be used.
Output file format
Output files for usage example
File: vector.strip
Sequence: pBlueScript Vector: pTYB1 No match Sequence: pBlueScript Vector: pBS_KS+ 5' sequence matches: From 67 to 83 with 0 mismatches 3' sequence matches: From 205 to 219 with 0 mismatches Sequences output to file: from 84 to 204 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC sequence trimmed from 3' end: TCGAGGTCGACGGTATCGATAAGCTTGATATCG Sequence: pBlueScript Vector: pLITMUS No match Sequence: litmus.seq Vector: pTYB1 No match Sequence: litmus.seq Vector: pBS_KS+ No match Sequence: litmus.seq Vector: pLITMUS 5' sequence matches: From 43 to 61 with 0 mismatches 3' sequence matches: From 183 to 199 with 0 mismatches Sequences output to file: from 62 to 182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT GCAGGAATTCC sequence trimmed from 3' end: TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG GCCTTAAGTGAGTCGTATTACGGA Sequence: pTYB1.seq Vector: pTYB1 5' sequence matches: From 40 to 58 with 0 mismatches 3' sequence matches: From 180 to 196 with 0 mismatches Sequences output to file: from 59 to 179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca cacagtgacatgagagacacagatatagagacagatagacgatagacaga cagcatatatagacagatagc sequence trimmed from 5' end: CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG CGAATTCC sequence trimmed from 3' end: TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT Sequence: pTYB1.seq Vector: pBS_KS+ No match Sequence: pTYB1.seq Vector: pLITMUS No match |
File: vector.fasta
>pBlueScript_from_84_to_204 KS+ tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >litmus.seq_from_62_to_182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >pTYB1.seq_from_59_to_179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c |
Two types of output file are produced:
- The sequence file(s) - contain the trimmed subsequence(s) produced by vectorstrip either all in one file, or in separate files if the command line flag -ossingle is used.
- Results summary file
Data files
None.Notes
vectorstrip is intended for stripping vector sequence from the ends of sequences of interest. For example, if a fragment has been cloned into a vector and then sequenced, the sequence may contain vector data eg from the cloning polylinker at the 5' and 3' ends of the sequence. vectorstrip will remove these contaminating regions and output trimmed sequence ready for input into another application.
vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected.
Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory.
The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted.
Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below.
References
None.Warnings
None.Diagnostic Error Messages
No suitable vectors found - exiting
indicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile.Illegal pattern
indicates that one of the vector patterns could not be compiled and therefore cannot be searched.5' and 3' sequence matches are identical; inconclusive
indicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert.
Exit status
It always exits with status 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| featreport | Reads and writes a feature table |
| feattext | Return a feature table original text |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqcount | Reads and counts sequences |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| yank | Add a sequence reference (a full USA) to a list file |