CSC

 
 
Tehdyt toimenpiteet
EMBOSS: cutseq
cutseq

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Removes a section from a sequence

Description

This simple editing program allows you to cut out a region from your sequence by specifying the begin and end positions of the region to remove. It removes the sequence from the specified start to the end positions (inclusive) and writes the remaining sequence to the output file.

Usage

Here is a sample session with cutseq

To remove bases 10 to 12 from a database entry and write to the new sequence file 'gatta2.seq': 


% cutseq tembl:x13776 gatta2.seq -from=10 -to=12 
Removes a section from a sequence

Go to the input files for this example
Go to the output files for this example

Example 2

To remove the first 20 bases from 'tembl:x13776' and write it to 'jsh.seq': 


% cutseq tembl:x13776 -from=1 -to=20 -out=jsh.seq 
Removes a section from a sequence

Go to the output files for this example

Example 3

If the default start and end positions are accepted, then all of the sequence is removed! 


% cutseq tembl:x13776 starta.seq -sbeg=-1000 -send=1290 
Removes a section from a sequence
Start of region to delete [1168]: 
End of region to delete [1290]:

Go to the output files for this example

Command line arguments 

Removes a section from a sequence
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
   -from               integer    [Start of sequence (0)] This is the start
                                  position (inclusive) of the section of the
                                  sequence that you wish to remove. (Any
                                  integer value)
   -to                 integer    [End of sequence (0)] This is the end
                                  position (inclusive) of the section of the
                                  sequence that you wish to remove. (Any
                                  integer value)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)		 sequence (Gapped) sequence filename and optional format, or reference (input USA) Readable sequence Required
-from integer This is the start position (inclusive) of the section of the sequence that you wish to remove. Any integer value Start of sequence (0)
-to integer This is the end position (inclusive) of the section of the sequence that you wish to remove. Any integer value End of sequence (0)
[-outseq]
(Parameter 2)		 seqout Sequence filename and optional format (output USA) Writeable sequence <*>.format
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1
-sbegin_sequence		 integer Start of the sequence to be used Any integer value 0
-send1
-send_sequence		 integer End of the sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence		 boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence		 boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence		 boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence		 boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence		 boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence		 boolean Make upper case Boolean value Yes/No N
-sformat1
-sformat_sequence		 string Input sequence format Any string  
-sdbname1
-sdbname_sequence		 string Database name Any string  
-sid1
-sid_sequence		 string Entryname Any string  
-ufo1
-ufo_sequence		 string UFO features Any string  
-fformat1
-fformat_sequence		 string Features format Any string  
-fopenfile1
-fopenfile_sequence		 string Features file name Any string  
"-outseq" associated seqout qualifiers
-osformat2
-osformat_outseq		 string Output seq format Any string  
-osextension2
-osextension_outseq		 string File name extension Any string  
-osname2
-osname_outseq		 string Base file name Any string  
-osdirectory2
-osdirectory_outseq		 string Output directory Any string  
-osdbname2
-osdbname_outseq		 string Database name to add Any string  
-ossingle2
-ossingle_outseq		 boolean Separate file for each entry Boolean value Yes/No N
-oufo2
-oufo_outseq		 string UFO features Any string  
-offormat2
-offormat_outseq		 string Features format Any string  
-ofname2
-ofname_outseq		 string Features file name Any string  
-ofdirectory2
-ofdirectory_outseq		 string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

cutseq reads a single nucleotide or protein sequence.

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

'tembl:x13776' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:x13776

ID   X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC   Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   DOI; 10.1016/0014-5793(89)80249-2.
RX   PUBMED; 2495988.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene (amiR) of
RT   Pseudomonas aeruginosa";
RL   FEBS Lett. 246(1-2):39-43(1989).
XX
RN   [3]
RP   1-1292
RX   PUBMED; 1907262.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA sequence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product";
RL   J. Bacteriol. 173(16):4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   GOA; Q51417.
DR   InterPro; IPR003211; AmiSUreI_transpt.
DR   UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   /replace=""
FT                   /note="ClaI fragment deleted in pSW36,  constitutive
FT                   phenotype"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//

Output file format

The output is a standard EMBOSS sequence file.

The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Output files for usage example

File: gatta2.seq

>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
ggtaccgctcgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgatcta
cctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcacagg
agaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccgaaa
ccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagc
aactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccg
gcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccggggggtac
ggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagc
gcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccgaaca
tcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctgattc
gccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaagca
accatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatctaca
ttccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgc
gcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcgcca
tcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcgagg
cggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgccttact
tctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttcttcc
cggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgctcg
gccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgtacg
acatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccacagcc
gcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagt
cgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggtccg
ccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcgcga
gttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgcagct
gatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgtgcc
ggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgcgct
gctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccccgc
ggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcgatgc
ccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaagct
gaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaaccaggc
caaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacctgtc
gcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctgggaaa
cgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgtcat
catgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctggtt
gctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgctgag
cgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaaggc
cggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagttcct
cgag

Output files for usage example 2

File: jsh.seq

>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
tgctcgatcaccaccagccgggcgacgggaactgcacgatctacctggcgagcctggagc
acgagcgggttcgcttcgtacggcgctgagcgacagtcacaggagaggaaacggatggga
tcgcaccaggagcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat
atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaaccgcgagggc
ggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccggcggcgacccggaccgc
tatcggctgtgcgccgaggacttcattcgcaaccggggggtacggttcctcgtgggctgc
tacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagcgcgccgacgcgctgctc
tgctacccgaccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg
gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccactacggcgagcgg
gtggtgttcatcggctcggactacatctatccgcgggaaagcaaccatgtgatgcgccac
ctgtatcgccagcacggcggcacggtgctcgaggaaatctacattccgctgtatccctcc
gacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgcgcgccgacgtggtcttc
tccaccgtggtgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc
gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggtggcgaagatg
gagagtgacgtggcagaggggcaggtggtggtcgcgccttacttctccagcatcgatacg
cccgccagccgggccttcgtccaggcctgccatggtttcttcccggagaacgcgaccatc
accgcctgggccgaggcggcctactggcagaccttgttgctcggccgcgccgcgcaggcc
gcaggcaactggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg
ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtcttcgcgcatc
gcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagtcgcccgaaccgattcgc
cccgacccttatgtcgtcgtgcataacctcgacgactggtccgccagcatgggcggggga
ccgctcccatgagcgccaactcgctgctcggcagcctgcgcgagttgcaggtgctggtcc
tcaacccgccgggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt
cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggacgtggtcttca
ccagcattttccagaatggccaccacgacgagatcgctgcgctgctcgccgccgggactc
cgcgcactaccctggtggcgctggtggagtacgaaagccccgcggtgctctcgcagatca
tcgagctggagtgccacggcgtgatcacccagccgctcgatgcccaccgggtgctgcctg
tgctggtatcggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc
agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtgttgctgatgc
agcgccatggctgggacgagcgcgaggcgcaccagcacctgtcgcgggaagcgatgaagc
ggcgcgagccgatcctgaagatcgctcaggagttgctgggaaacgagccgtccgcctgag
cgatccgggccgaccagaacaataacaagaggggtatcgtcatcatgctgggactggttc
tgctgtacgttggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg
gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgcgtcgcgttct
acctgatcttttccgcagcagccgggcagggctcgctgaaggccggagcgctgaccctgc
tattcgcttttacctatctgtgggtggccgccaaccagttcctcgag

Output files for usage example 3

File: starta.seq

>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation

Data files

None.

Notes

Qualifiers that are in-built for sequence datatypes allow the input and output files to be specified in more detail, for example, the format for the output files.

References

None.

Warnings

You can delete a complete sequence and write out an empty sequence file.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0

Known bugs

None.

See also

Program name Description
aligncopy Reads and writes alignments
aligncopypair Reads and writes pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
degapseq Removes non-alphabetic (e.g. gap) characters from sequences
descseq Alter the name or description of a sequence
entret Retrieves sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Reads and writes a feature table
featreport Reads and writes a feature table
feattext Return a feature table original text
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Masks all ambiguity characters in nucleotide sequences with N
maskambigprot Masks all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Reads and writes (returns) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Reads and counts sequences
seqret Reads and writes (returns) sequences
seqretsetall Reads and writes (returns) many sets of sequences
seqretsplit Reads sequences and writes them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Reads and writes (returns) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Removes vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Completed 26 Jan 1999

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None