![]() |
union |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Concatenate multiple sequences into a single sequenceDescription
union reads in several sequences, concatenates them and writes them out as a single sequence. The input is typically a list file containing references to multiple sequences or subsequences (regions of a sequence). Optionally, feature information will be used.
The output can have source features generated which document composite sequences in the EMBL/GenBank feature table. The -findoverlap optin checks for overlaps between adjacent joined regions and reports them in the overlap file.
Usage
Here is a sample session with unionThe file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:x65923':
% union Concatenate multiple sequences into a single sequence Input (gapped) sequence(s): @cds.list output sequence [x65921.fasta]: |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Concatenate multiple sequences into a single sequence Version: EMBOSS:6.4.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall (Gapped) sequence(s) filename and optional format, or reference (input USA) [-outseq] seqout [ |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-sequence] (Parameter 1) |
seqall | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
[-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
Additional (Optional) qualifiers | ||||
-overlapfile | outfile | Sequence overlaps output file (optional) | Output file | <*>.union |
Advanced (Unprompted) qualifiers | ||||
-feature | boolean | Use feature information | Boolean value Yes/No | No |
-source | boolean | Create source features | Boolean value Yes/No | No |
-findoverlap | boolean | Look for overlaps when joining | Boolean value Yes/No | No |
Associated qualifiers | ||||
"-sequence" associated seqall qualifiers | ||||
-sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
-send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |
-sid1 -sid_sequence |
string | Entryname | Any string | |
-ufo1 -ufo_sequence |
string | UFO features | Any string | |
-fformat1 -fformat_sequence |
string | Features format | Any string | |
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
"-outseq" associated seqout qualifiers | ||||
-osformat2 -osformat_outseq |
string | Output seq format | Any string | |
-osextension2 -osextension_outseq |
string | File name extension | Any string | |
-osname2 -osname_outseq |
string | Base file name | Any string | |
-osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
-osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
-ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
-oufo2 -oufo_outseq |
string | UFO features | Any string | |
-offormat2 -offormat_outseq |
string | Features format | Any string | |
-ofname2 -ofname_outseq |
string | Features file name | Any string | |
-ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
"-overlapfile" associated outfile qualifiers | ||||
-odirectory | string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
Input file format
The input can be any set of sequences in a file of multiple sequence entries or in a List file. The sequences are concatenated in the order in which they appear in the file.Input files for usage example
File: cds.list
tembl-id:X65921[782:856] tembl-id:X65921[951:1095] tembl-id:X65921[1557:1612] tembl-id:X65921[1787:1912] |
You may find the program yank useful for creating List files.
Output file format
Output files for usage example
File: x65921.fasta
>X65921 X65921.1 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.
Data files
None.Notes
union is most useful when the input sequences are specified in a "list file". A list file contain references to any number of sequences which are retrieved from some other file or database. Each sequence reference is a Uniform Sequence Address (USA) which can include the specification of sub-regions of the sequence, eg. em:x65923[20:55]). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.
References
None.Warnings
None.Diagnostic Error Messages
None.Exit status
It always exits with status 0.Known bugs
None.See also
Program name | Description |
---|---|
aligncopy | Reads and writes alignments |
aligncopypair | Reads and writes pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Removes a section from a sequence |
degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
descseq | Alter the name or description of a sequence |
entret | Retrieves sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Reads and writes a feature table |
featreport | Reads and writes a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
maskambigprot | Masks all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Reads and writes (returns) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Reads and counts sequences |
seqret | Reads and writes (returns) sequences |
seqretsetall | Reads and writes (returns) many sets of sequences |
seqretsplit | Reads sequences and writes them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Reads and writes (returns) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
You may find the program yank useful for creating List files.
Author(s)
Peter RiceEuropean Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.