Tehdyt toimenpiteet
|
supermatcher |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Calculate approximate local pair-wise alignments of larger sequencesDescription
supermatcher calculates an approximate alignment between all the sequences in a first set of sequences and all those from a second stream, typically a database. The alignments are written to a standard alignment file. A combination of a word-match and Smith-Waterman local alignment (dynamic programming) algorithms are used. The alignments will be less accurate than an optimal alignment generated by full dynamic programming, but the program will run faster and use less memory, which means it is suitable for use with larger sequences.
Usage
Here is a sample session with supermatcher
% supermatcher @eclac.list tembl:j01636 -word 50 Calculate approximate local pair-wise alignments of larger sequences Gap opening penalty [10.0]: Gap extension penalty [0.5]: 3.0 Output alignment [j01636.supermatcher]: |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Calculate approximate local pair-wise alignments of larger sequences
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-asequence] seqall Sequence(s) filename and optional format, or
reference (input USA)
[-bsequence] seqset Sequence set filename and optional format,
or reference (input USA)
-gapopen float [10.0 for any sequence type] Gap opening
penalty (Number from 0.000 to 100.000)
-gapextend float [0.5 for any sequence type] Gap extension
penalty (Number from 0.000 to 10.000)
[-outfile] align [*.supermatcher] Output alignment file name
(default -aformat simple)
Additional (Optional) qualifiers:
-datafile matrixf [EBLOSUM62 for protein, EDNAFULL for DNA]
This is the scoring matrix file used when
comparing sequences. By default it is the
file 'EBLOSUM62' (for proteins) or the file
'EDNAFULL' (for nucleic sequences). These
files are found in the 'data' directory of
the EMBOSS installation.
-minscore float [0] Minimum alignment score to report an
alignment. (Number 0.000 or more)
-width integer [16] Alignment width (Integer 1 or more)
-wordlen integer [6] Word length for initial matching
(Integer 3 or more)
-errorfile outfile [supermatcher.error] Error file to be
written to for failed alignments
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-asequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-bsequence" associated qualifiers
-sbegin2 integer Start of each sequence to be used
-send2 integer End of each sequence to be used
-sreverse2 boolean Reverse (if DNA)
-sask2 boolean Ask for begin/end/reverse
-snucleotide2 boolean Sequence is nucleotide
-sprotein2 boolean Sequence is protein
-slower2 boolean Make lower case
-supper2 boolean Make upper case
-sformat2 string Input sequence format
-sdbname2 string Database name
-sid2 string Entryname
-ufo2 string UFO features
-fformat2 string Features format
-fopenfile2 string Features file name
"-outfile" associated qualifiers
-aformat3 string Alignment format
-aextension3 string File name extension
-adirectory3 string Output directory
-aname3 string Base file name
-awidth3 integer Alignment width
-aaccshow3 boolean Show accession number in the header
-adesshow3 boolean Show description in the header
-ausashow3 boolean Show the full USA in the alignment
-aglobal3 boolean Show the full sequence in alignment
"-errorfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-asequence] (Parameter 1) |
seqall | Sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-bsequence] (Parameter 2) |
seqset | Sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required |
| -gapopen | float | Gap opening penalty | Number from 0.000 to 100.000 | 10.0 for any sequence type |
| -gapextend | float | Gap extension penalty | Number from 0.000 to 10.000 | 0.5 for any sequence type |
| [-outfile] (Parameter 3) |
align | Output alignment file name | (default -aformat simple) | <*>.supermatcher |
| Additional (Optional) qualifiers | ||||
| -datafile | matrixf | This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. | Comparison matrix file in EMBOSS data path | EBLOSUM62 for protein EDNAFULL for DNA |
| -minscore | float | Minimum alignment score to report an alignment. | Number 0.000 or more | 0 |
| -width | integer | Alignment width | Integer 1 or more | 16 |
| -wordlen | integer | Word length for initial matching | Integer 3 or more | 6 |
| -errorfile | outfile | Error file to be written to for failed alignments | Output file | supermatcher.error |
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-asequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_asequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_asequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_asequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_asequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_asequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_asequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_asequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_asequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_asequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_asequence |
string | Database name | Any string | |
| -sid1 -sid_asequence |
string | Entryname | Any string | |
| -ufo1 -ufo_asequence |
string | UFO features | Any string | |
| -fformat1 -fformat_asequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_asequence |
string | Features file name | Any string | |
| "-bsequence" associated seqset qualifiers | ||||
| -sbegin2 -sbegin_bsequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send2 -send_bsequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse2 -sreverse_bsequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask2 -sask_bsequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide2 -snucleotide_bsequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein2 -sprotein_bsequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower2 -slower_bsequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper2 -supper_bsequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat2 -sformat_bsequence |
string | Input sequence format | Any string | |
| -sdbname2 -sdbname_bsequence |
string | Database name | Any string | |
| -sid2 -sid_bsequence |
string | Entryname | Any string | |
| -ufo2 -ufo_bsequence |
string | UFO features | Any string | |
| -fformat2 -fformat_bsequence |
string | Features format | Any string | |
| -fopenfile2 -fopenfile_bsequence |
string | Features file name | Any string | |
| "-outfile" associated align qualifiers | ||||
| -aformat3 -aformat_outfile |
string | Alignment format | Any string | simple |
| -aextension3 -aextension_outfile |
string | File name extension | Any string | |
| -adirectory3 -adirectory_outfile |
string | Output directory | Any string | |
| -aname3 -aname_outfile |
string | Base file name | Any string | |
| -awidth3 -awidth_outfile |
integer | Alignment width | Any integer value | 0 |
| -aaccshow3 -aaccshow_outfile |
boolean | Show accession number in the header | Boolean value Yes/No | N |
| -adesshow3 -adesshow_outfile |
boolean | Show description in the header | Boolean value Yes/No | N |
| -ausashow3 -ausashow_outfile |
boolean | Show the full USA in the alignment | Boolean value Yes/No | N |
| -aglobal3 -aglobal_outfile |
boolean | Show the full sequence in alignment | Boolean value Yes/No | N |
| "-errorfile" associated outfile qualifiers | ||||
| -odirectory | string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
Input file format
supermatcher reads two sets of nucleotide or protein sequences.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
Input files for usage example
'tembl:j01636' is a sequence entry in the example nucleic acid database 'tembl'
File: eclac.list
#Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 |
Database entry: tembl:j01636
ID J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
XX
AC J01636; J01637; K01483; K01793;
XX
DT 30-NOV-1990 (Rel. 26, Created)
DT 09-SEP-2004 (Rel. 81, Last updated, Version 8)
XX
DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW lacZ gene; mutagenesis; palindrome; promoter region;
KW thiogalactoside acetyltransferase.
XX
OS Escherichia coli
OC Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC Enterobacteriaceae; Escherichia.
XX
RN [1]
RP 1243-1266
RX DOI; 10.1073/pnas.70.12.3581.
RX PUBMED; 4587255.
RA Gilbert W., Maxam A.;
RT "The nucleotide sequence of the lac operator";
RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
XX
RN [2]
RP 1246-1308
RX DOI; 10.1073/pnas.70.12.3585.
RX PUBMED; 4587256.
RA Maizels N.M.;
RT "The nucleotide sequence of the lactose messenger ribonucleic acid
RT transcribed from the UV5 promoter mutant of Escherichia coli";
RL Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
XX
RN [3]
RX PUBMED; 4598642.
RA Gilbert W., Maizels N., Maxam A.;
RT "Sequences of controlling regions of the lactose operon";
RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN [4]
RA Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT "Lactose operator sequences and the action of lac repressor";
RL (in) Sund H., Blauer G. (Eds.);
RL PROTEIN-LIGAND INTERACTIONS:193-207;
RL Walter de Gruyter, New York (1975)
XX
RN [5]
RP 1146-1282
[Part of this file has been deleted for brevity]
cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560
ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620
ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680
ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740
gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800
aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860
gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920
ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980
cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040
agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100
gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160
ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220
ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280
ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340
cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400
tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460
tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520
atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580
gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640
gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700
caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760
gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820
taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880
aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940
acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000
atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060
ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120
taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180
tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240
tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300
attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360
ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420
gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480
gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540
atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600
atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660
gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720
accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780
agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840
ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900
tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960
taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020
acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080
caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140
tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200
gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260
ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320
cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380
actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440
cagcccgccc atggtaacca ccggcagagc ggtcgac 7477
//
|
Output file format
The output is a standard EMBOSS alignment file.
The results can be output in one of several styles by using the command-line qualifier -aformat xxx, where 'xxx' is replaced by the name of the required format. Some of the alignment formats can cope with an unlimited number of sequences, while others are only for pairs of sequences.
The available multiple alignment format names are: multiple, simple, fasta, msf, clustal, mega, meganon, nexus,, nexusnon, phylip, phylipnon, selex, treecon, tcoffee, debug, srs.
The available pairwise alignment format names are: pair, markx0, markx1, markx2, markx3, markx10, match, sam, bam, score, srspair
See: http://emboss.sf.net/docs/themes/AlignFormats.html for further information on alignment formats.
By default the output is in 'simple' format.
Output files for usage example
File: supermatcher.error
|
|
File: j01636.supermatcher
########################################
# Program: supermatcher
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: supermatcher
# [-asequence] @../../data/eclac.list
# [-bsequence] tembl:j01636
# -wordlen 50
# -gapextend 3.0
# Align_format: simple
# Report_file: j01636.supermatcher
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: J01636
# 2: J01636
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 3.0
#
# Length: 7477
# Identity: 7477/7477 (100.0%)
# Similarity: 7477/7477 (100.0%)
# Gaps: 0/7477 ( 0.0%)
# Score: 37385.0
#
#
#=======================================
J01636 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50
J01636 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100
J01636 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150
J01636 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200
J01636 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250
[Part of this file has been deleted for brevity]
V00296 2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 2550
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 3836
V00296 2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 2600
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 3886
V00296 2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 2650
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 3936
V00296 2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 2700
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 3986
V00296 2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 2750
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 4036
V00296 2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 2800
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 4086
V00296 2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 2850
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 4136
V00296 2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 2900
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 4186
V00296 2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 2950
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 4236
V00296 2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 3000
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 4286
V00296 3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 3050
||||||||||||||||||||||||||||||||||||||||||||||||||
J01636 4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 4336
V00296 3051 gttggtctggtgtcaaaaataataataa 3078
||||||||||||||||||||||||||||
J01636 4337 gttggtctggtgtcaaaaataataataa 4364
#---------------------------------------
#---------------------------------------
|
The file 'supermatcher.error' will contain any errors that occured during the program. This may be that wordmatch could not find any matches hence no suitable start point is found for the smith-waterman calculation.
Data files
For protein sequences EBLOSUM62 is used for the substitution matrix. For nucleotide sequence, EDNAMAT is used. Others can be specified.
EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".
The directories are searched in the following order:
- . (your current directory)
- .embossdata (under your current directory)
- ~/ (your home directory)
- ~/.embossdata
Notes
supermatcher generates approximate local alignments for large sequences. The alignments are approximate because as a first step, all the sequence word matches between two sequences are found. By identifying the highest scoring, non-overlapping matches a set of approximate local alignments are calculated for two sequences. These give the centre points for more acurate Smith-Waterman type alignments in a region of width specified by the user. The use of Smith-Waterman in narrow regions means the alignment overall will be rough, but due to the memory saving much larger sequences can be aligned.
For the Swmith-Waterman alignment, the gap open and extension penalties and substition matrix may be specified, the later by default is EBLOSUM62 for protein sequences and EDNAMAT for nucleotide sequence.
For the word-match alignment, the word length may be specified. The time required for alignment depends very much on word size. A small word size (e.g. 4) may take a very long time even for short sequences. Much larger word sizes (e.g. 30) will give a very quick result. The default of 16 should give reasonably fast alignments.
References
None.Warnings
supermatcher performs a Smith & Waterman alignment (albeit in a narrow best-matching regions identified by simple word-match) and therefore can use huge amounts of memory if the sequences are large. The longer the sequences and the wider the specified alignment width, the more memory will be used. If the program terminates due to lack of memory you can try running the UNIX command limit to see if your stack or memory usage have been limited and if so, run unlimit, (e.g.: % unlimit stacksize).
supermatcher has two sequence inputs. The first (asequence) is a database or large file which is read one sequence at a time. The second (bsequence) is a "sequence set" which is loaded into memory. If one of the inputs has more number of sequences than the other one, specifying the file with many number of sequences first would be useful to decrease the amount of memory used while supermatcher running.
Because the alignment is made within a narrow area each side of the 'best' diagonal identified by word-matching, if there are sufficient indels between the two sequences, then the path of the Smith & Waterman alignment can wander outside of this area. Making the width larger can avoid this problem, but you then use more memory.
Diagnostic Error Messages
None.Exit status
It always exits with a status of 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| matcher | Waterman-Eggert local alignment of two sequences |
| seqmatchall | All-against-all word comparison of a sequence set |
| water | Smith-Waterman local alignment of sequences |
| wordfinder | Match large sequences against one or more other sequences |
| wordmatch | Finds regions of identity (exact matches) of two sequences |
Author(s)
Ian Longden formerly at:Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.