CSC

 
 
Tehdyt toimenpiteet
EMBOSS: shuffleseq
shuffleseq

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Shuffles a set of sequences maintaining composition

Description

shuffleseq reads one or more sequences and writes them out again in a random (shuffled) order. The number of shuffles may be specified. Only the order of sequences is changed, no bases or residues are changed.

Usage

Here is a sample session with shuffleseq

This makes two randomised copies of the input sequence: 


% shuffleseq -shuffle 2 
Shuffles a set of sequences maintaining composition
Input sequence(s): tembl:L48662
output sequence(s) [l48662.fasta]:

Go to the input files for this example
Go to the output files for this example

Command line arguments 

Shuffles a set of sequences maintaining composition
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -shuffle            integer    [1] Number of shuffles (Any integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)		 seqall Sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)		 seqoutall Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-shuffle integer Number of shuffles Any integer value 1
Associated qualifiers
"-sequence" associated seqall qualifiers
-sbegin1
-sbegin_sequence		 integer Start of each sequence to be used Any integer value 0
-send1
-send_sequence		 integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence		 boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence		 boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence		 boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence		 boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence		 boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence		 boolean Make upper case Boolean value Yes/No N
-sformat1
-sformat_sequence		 string Input sequence format Any string  
-sdbname1
-sdbname_sequence		 string Database name Any string  
-sid1
-sid_sequence		 string Entryname Any string  
-ufo1
-ufo_sequence		 string UFO features Any string  
-fformat1
-fformat_sequence		 string Features format Any string  
-fopenfile1
-fopenfile_sequence		 string Features file name Any string  
"-outseq" associated seqoutall qualifiers
-osformat2
-osformat_outseq		 string Output seq format Any string  
-osextension2
-osextension_outseq		 string File name extension Any string  
-osname2
-osname_outseq		 string Base file name Any string  
-osdirectory2
-osdirectory_outseq		 string Output directory Any string  
-osdbname2
-osdbname_outseq		 string Database name to add Any string  
-ossingle2
-ossingle_outseq		 boolean Separate file for each entry Boolean value Yes/No N
-oufo2
-oufo_outseq		 string UFO features Any string  
-offormat2
-offormat_outseq		 string Features format Any string  
-ofname2
-ofname_outseq		 string Features file name Any string  
-ofdirectory2
-ofdirectory_outseq		 string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

shuffleseq reads one or more nucleotide or protein sequences.

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

'tembl:L48662' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:L48662

ID   L48662; SV 1; linear; mRNA; STD; MUS; 366 BP.
XX
AC   L48662;
XX
DT   04-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 4)
XX
DE   Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy
DE   chain mRNA.
XX
KW   .
XX
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea;
OC   Muridae; Murinae; Mus.
XX
RN   [1]
RP   1-366
RX   DOI; 10.1002/eji.1830260939.
RX   PUBMED; 8814271.
RA   Wloch M.K., Alexander A.L., Pippen A.M., Pisetsky D.S., Gilkeson G.S.;
RT   "Differences in V kappa gene utilization and VH CDR3 sequence among
RT   anti-DNA from C3H-lpr mice and lupus mice with nephritis";
RL   Eur. J. Immunol. 26(9):2225-2233(1996).
XX
DR   IMGT/LIGM; L48662.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..366
FT                   /organism="Mus musculus"
FT                   /strain="C3H/HeJ-lpr/lpr"
FT                   /mol_type="mRNA"
FT                   /cell_line="C3H/F2-11"
FT                   /cell_type="hybridoma"
FT                   /tissue_type="spleen"
FT                   /db_xref="taxon:10090"
XX
SQ   Sequence 366 BP; 100 A; 90 C; 85 G; 89 T; 2 other;
     gagnnccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg        60
     tcctgcaagg cttctggata cacattcact agctatgtta tgcactgggt gaatcagaag       120
     cctgggcagg gccttgagtg gattggatat attaatcctt acaatgatgg tactaactac       180
     aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcctccag cacagcctac       240
     atggagttca gcagcctgac ctctgaggac tctgcggtct attactgtgc aagaaaaact       300
     tcctactata gtaacctata ttactttgac tactggggcc aaggcaccac tctcacagtc       360
     tcctca                                                                  366
//

Output file format

The output is a standard EMBOSS sequence file.

The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Output files for usage example

File: l48662.fasta

>L48662 L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA.
aggtttttatattacaagcatactaagagactcgcgatgatcgcacaattccaaatgtgc
tcatgggtgtagcaagaacctcaaataaaagggcaaccatgagggtaaagtctccgcatg
agcccctgggacgcgagagactttctcccgctagtgggtcgaacctgcagtgtcgataat
tggagttaaaatcgcagcatttacggccatgaattgtgtcgatanacgattcacgcaatc
gttaagatcaggttcattgggntcacaaaccgtaggccccccgttgcctgacgcgtaacg
ttcggatttccgtgacttcatctgactactctgtcacattcttacacgacaagctcaaca
agccgg
>L48662 L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA.
gtggatggtatccctaacccatgacttgcgattccattgactaataccgatttcgctatg
cgaataatactgcacaataagcgctgggggttggtttaaanttgcgatgtattatcaggt
gcatcatacgcgtgtcttcaatcgcaggagaatacaaactcagtcccaagcctaaggcgc
gtgagacttcattagggcaacggatactgctaactagttaaactcgcatgtaacaactca
cctgagcggtcgtacatgggcctctcttcccgaagggttgttcgaaaaaagcattgatac
aggccaggcaagcaccacgtgtcagcactacgatggccgttntcaaagtagctcatacag
cctcgc

Each run will produce a different sequence.

Note that these two sequences have the same name.

Data files

None.

Notes

shuffleseq is useful for producing sets of sequences with randomised order which can be used for checking the statistics of sequence similarity searches.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
msbar Mutate a sequence

Author(s)

Michael Schmitz formerly at:
Lawrence Berkeley Labs, USA

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None