Tehdyt toimenpiteet
|
fuzznuc |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Search for patterns in nucleotide sequencesDescription
fuzznuc searches for a specified PROSITE-style pattern in nucleotide sequences. Such patterns are specifications of a (typically short) length of sequence to be found. They can specify a search for an exact sequence or they can allow various ambiguities, matches to variable lengths of sequence and repeated subsections of the sequence. One or more nucleotide sequences are read from file. The output is a standard EMBOSS report file that includes data such as location and score of any matches.
Algorithm
fuzznuc intelligently selects the optimum searching algorithm to use, depending on the complexity of the search pattern specified.
Usage
Here is a sample session with fuzznuc
% fuzznuc Search for patterns in nucleotide sequences Input nucleotide sequence(s): tembl:L46634 Search pattern: AAGCTT Output report [l46634.fuzznuc]: |
Go to the input files for this example
Go to the output files for this example
Example 2
% fuzznuc Search for patterns in nucleotide sequences Input nucleotide sequence(s): tembl:L46634 Search pattern: @nucseq.pat Output report [l46634.fuzznuc]: |
Go to the input files for this example
Go to the output files for this example
Example 3
% fuzznuc -pname test Search for patterns in nucleotide sequences Input nucleotide sequence(s): tembl:L46634 Search pattern: @nucsimple.pat Output report [l46634.fuzznuc]: |
Go to the input files for this example
Go to the output files for this example
Example 4
% fuzznuc Search for patterns in nucleotide sequences Input nucleotide sequence(s): tembl:L46634 Search pattern: @nuc.pat Output report [l46634.fuzznuc]: |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Search for patterns in nucleotide sequences
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
-pattern pattern The standard IUPAC one-letter codes for the
nucleotides are used.
The symbol 'n' is used for a position where
any nucleotide is accepted.
Ambiguities are indicated by listing the
acceptable nucleotides for a given position,
between square parentheses '[ ]'. For
example: [ACG] stands for A or C or G.
Ambiguities are also indicated by listing
between a pair of curly brackets '{ }' the
nucleotides that are not accepted at a given
position. For example: {AG} stands for any
nucleotides except A and G.
Each element in a pattern is separated from
its neighbor by a '-'. (Optional in
fuzznuc).
Repetition of an element of the pattern can
be indicated by following that element with
a numerical value or a numerical range
between parenthesis. Examples: N(3)
corresponds to N-N-N, N(2,4) corresponds to
N-N or N-N-N or N-N-N-N.
When a pattern is restricted to either the
5' or 3' end of a sequence, that pattern
either starts with a '<' symbol or
respectively ends with a '>' symbol.
A period ends the pattern. (Optional in
fuzznuc).
For example, [CG](5)TG{A}N(1,5)C
[-outfile] report [*.fuzznuc] Output report file name (default
-rformat seqtable)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-complement boolean [N] Search complementary strand
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-pattern" associated qualifiers
-pformat string File format
-pmismatch integer Pattern mismatch
-pname string Pattern base name
"-outfile" associated qualifiers
-rformat2 string Report format
-rname2 string Base file name
-rextension2 string File name extension
-rdirectory2 string Output directory
-raccshow2 boolean Show accession number in the report
-rdesshow2 boolean Show description in the report
-rscoreshow2 boolean Show the score in the report
-rstrandshow2 boolean Show the nucleotide strand in the report
-rusashow2 boolean Show the full USA in the report
-rmaxall2 integer Maximum total hits to report
-rmaxseq2 integer Maximum hits to report for one sequence
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) |
seqall | Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| -pattern | pattern | The standard IUPAC one-letter codes for the nucleotides are used. The symbol 'n' is used for a position where any nucleotide is accepted. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses '[ ]'. For example: [ACG] stands for A or C or G. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G. Each element in a pattern is separated from its neighbor by a '-'. (Optional in fuzznuc). Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N. When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzznuc). For example, [CG](5)TG{A}N(1,5)C | Property value(s) | |
| [-outfile] (Parameter 2) |
report | Output report file name | (default -rformat seqtable) | <*>.fuzznuc |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| -complement | boolean | Search complementary strand | Boolean value Yes/No | No |
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |
| -sid1 -sid_sequence |
string | Entryname | Any string | |
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |
| -fformat1 -fformat_sequence |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
| "-pattern" associated pattern qualifiers | ||||
| -pformat | string | File format | Any string | |
| -pmismatch | integer | Pattern mismatch | Any integer value | 0 |
| -pname | string | Pattern base name | Any string | |
| "-outfile" associated report qualifiers | ||||
| -rformat2 -rformat_outfile |
string | Report format | Any string | seqtable |
| -rname2 -rname_outfile |
string | Base file name | Any string | |
| -rextension2 -rextension_outfile |
string | File name extension | Any string | |
| -rdirectory2 -rdirectory_outfile |
string | Output directory | Any string | |
| -raccshow2 -raccshow_outfile |
boolean | Show accession number in the report | Boolean value Yes/No | N |
| -rdesshow2 -rdesshow_outfile |
boolean | Show description in the report | Boolean value Yes/No | N |
| -rscoreshow2 -rscoreshow_outfile |
boolean | Show the score in the report | Boolean value Yes/No | Y |
| -rstrandshow2 -rstrandshow_outfile |
boolean | Show the nucleotide strand in the report | Boolean value Yes/No | Y |
| -rusashow2 -rusashow_outfile |
boolean | Show the full USA in the report | Boolean value Yes/No | N |
| -rmaxall2 -rmaxall_outfile |
integer | Maximum total hits to report | Any integer value | 0 |
| -rmaxseq2 -rmaxseq_outfile |
integer | Maximum hits to report for one sequence | Any integer value | 0 |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
Input file format
fuzznuc reads in one or more nucleotide sequences.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
Input files for usage example
'tembl:L46634' is a sequence entry in the example nucleic acid database 'tembl'
Database entry: tembl:L46634
ID L46634; SV 1; linear; genomic DNA; STD; VRL; 1272 BP.
XX
AC L46634; L46689;
XX
DT 06-NOV-1995 (Rel. 45, Created)
DT 04-MAR-2000 (Rel. 63, Last updated, Version 3)
XX
DE Human herpesvirus 7 (clone ED132'1.2) telomeric repeat region.
XX
KW telomeric repeat.
XX
OS Human herpesvirus 7
OC Viruses; dsDNA viruses, no RNA stage; Herpesvirales; Herpesviridae;
OC Betaherpesvirinae; Roseolovirus.
XX
RN [1]
RP 1-1272
RX PUBMED; 7494318.
RA Secchiero P., Nicholas J., Deng H., Xiaopeng T., van Loon N., Ruvolo V.R.,
RA Berneman Z.N., Reitz M.S.Jr., Dewhurst S.;
RT "Identification of human telomeric repeat motifs at the genome termini of
RT human herpesvirus 7: structural analysis and heterogeneity";
RL J. Virol. 69(12):8041-8045(1995).
XX
FH Key Location/Qualifiers
FH
FT source 1..1272
FT /organism="Human herpesvirus 7"
FT /strain="JI"
FT /mol_type="genomic DNA"
FT /clone="ED132'1.2"
FT /db_xref="taxon:10372"
FT repeat_region 207..928
FT /note="long and complex repeat region composed of various
FT direct repeats, including TAACCC (TRS), degenerate copies
FT of TRS motifs and a 14-bp repeat, TAGGGCTGCGGCCC"
FT misc_signal 938..998
FT /note="pac2 motif"
FT misc_feature 1009
FT /note="right genome terminus (...ACA)"
XX
SQ Sequence 1272 BP; 346 A; 455 C; 222 G; 249 T; 0 other;
aagcttaaac tgaggtcaca cacgacttta attacggcaa cgcaacagct gtaagctgca 60
ggaaagatac gatcgtaagc aaatgtagtc ctacaatcaa gcgaggttgt agacgttacc 120
tacaatgaac tacacctcta agcataacct gtcgggcaca gtgagacacg cagccgtaaa 180
ttcaaaactc aacccaaacc gaagtctaag tctcacccta atcgtaacag taaccctaca 240
actctaatcc tagtccgtaa ccgtaacccc aatcctagcc cttagcccta accctagccc 300
taaccctagc tctaacctta gctctaactc tgaccctagg cctaacccta agcctaaccc 360
taaccgtagc tctaagttta accctaaccc taaccctaac catgaccctg accctaaccc 420
tagggctgcg gccctaaccc tagccctaac cctaacccta atcctaatcc tagccctaac 480
cctagggctg cggccctaac cctagcccta accctaaccc taaccctagg gctgcggccc 540
taaccctaac cctagggctg cggcccgaac cctaacccta accctaaccc taaccctagg 600
gctgcggccc taaccctaac cctagggctg cggccctaac cctaacccta gggctgcggc 660
ccgaacccta accctaaccc taaccctagg gctgcggccc taaccctaac cctagggctg 720
cggccctaac cctaacccta actctagggc tgcggcccta accctaaccc taaccctaac 780
cctagggctg cggcccgaac cctagcccta accctaaccc tgaccctgac cctaacccta 840
accctaaccc taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta 900
accctaaccc taaccctaac cctaaccccg cccccactgg cagccaatgt cttgtaatgc 960
cttcaaggca ctttttctgc gagccgcgcg cagcactcag tgaaaaacaa gtttgtgcac 1020
gagaaagacg ctgccaaacc gcagctgcag catgaaggct gagtgcacaa ttttggcttt 1080
agtcccataa aggcgcggct tcccgtagag tagaaaaccg cagcgcggcg cacagagcga 1140
aggcagcggc tttcagactg tttgccaagc gcagtctgca tcttaccaat gatgatcgca 1200
agcaagaaaa atgttctttc ttagcatatg cgtggttaat cctgttgtgg tcatcactaa 1260
gttttcaagc tt 1272
//
|
Input files for usage example 2
File: nucseq.pat
>targetseq cg(2)c(3)taac cctagc(3)ta |
Input files for usage example 3
File: nucsimple.pat
cg(2)c(3)taac cctagc(3)ta |
Input files for usage example 4
File: nuc.pat
>pat1 cggccctaaccctagcccta >pat2 <mismatch=1> cg(2)c(3)taac cctagc(3)ta >pat3 cggc(2,4)taac(2,5) |
Pattern specification
Patterns for fuzznuc are based on the format of pattern used in the PROSITE database, with the difference that the terminating dot '.' and the hyphens, '-', between the characters are optional.The PROSITE pattern definition from the PROSITE documentation (amended to refer to nucleic acid sequences, not proteins) follows.
- The standard IUPAC one-letter codes for the nucleotides are used.
- The symbol `n' is used for a position where any nucleotide is accepted.
- Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses `[ ]'. For example: [ACG] stands for A or C or G.
- Ambiguities are also indicated by listing between a pair of curly brackets `{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G.
- Each element in a pattern is separated from its neighbor by a `-'. (Optional in fuzznuc).
- Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N.
- When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a `<' symbol or respectively ends with a `>' symbol.
- A period ends the pattern. (Optional in fuzznuc).
- All other characters, including spaces are not allowed.
For example, in the EMBL entry J01636 you can look for the pattern:
[CG](5)TG{A}N(1,5)C
This searches for "C or G" 5 times, followed by T and G, then anything except A, then any base (1 to 5 times) before a C.
You can use ambiguity codes for nucleic acid searches but not within [] or {} as they expand to bracketed counterparts. For example, "s" is expanded to "[GC]" therefore [S] would be expanded to [[GC]] which is illegal.
Note the use of X is reserved for proteins. You must use N for nucleic acids to refer to any base.
The search is case-independent, so 'AAA' matches 'aaa'.
Output file format
The output is a standard EMBOSS report file.
The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, draw, restrict, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.
See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.
By default fuzznuc writes a 'seqtable' report file.
Output files for usage example
File: l46634.fuzznuc
########################################
# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
# -sequence tembl:L46634
# -pattern AAGCTT
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################
#=======================================
#
# Sequence: L46634 from: 1 to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# pattern 0 AAGCTT
#
# Complement: No
#
#=======================================
Start End Strand Pattern Mismatch Sequence
1 6 + pattern: AAGCTT . aagctt
1267 1272 + pattern: AAGCTT . aagctt
#---------------------------------------
#---------------------------------------
#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 2
#---------------------------------------
|
Output files for usage example 2
File: l46634.fuzznuc
########################################
# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
# -sequence tembl:L46634
# -pattern @../../data/nucseq.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################
#=======================================
#
# Sequence: L46634 from: 1 to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# targetseq 0 cg(2)c(3)taaccctagc(3)ta
#
# Complement: No
#
#=======================================
Start End Strand Pattern Mismatch Sequence
429 448 + targetseq: cg(2)c(3)taaccctagc(3)ta . cggccctaaccctagcccta
491 510 + targetseq: cg(2)c(3)taaccctagc(3)ta . cggccctaaccctagcccta
#---------------------------------------
#---------------------------------------
#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 2
#---------------------------------------
|
Output files for usage example 3
File: l46634.fuzznuc
########################################
# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
# -pname test
# -sequence tembl:L46634
# -pattern @../../data/nucsimple.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################
#=======================================
#
# Sequence: L46634 from: 1 to: 1272
# HitCount: 13
#
# Pattern_name Mismatch Pattern
# test1 0 cg(2)c(3)taac
# test2 0 cctagc(3)ta
#
# Complement: No
#
#=======================================
Start End Strand Pattern Mismatch Sequence
429 438 + test1: cg(2)c(3)taac . cggccctaac
491 500 + test1: cg(2)c(3)taac . cggccctaac
535 544 + test1: cg(2)c(3)taac . cggccctaac
605 614 + test1: cg(2)c(3)taac . cggccctaac
631 640 + test1: cg(2)c(3)taac . cggccctaac
695 704 + test1: cg(2)c(3)taac . cggccctaac
721 730 + test1: cg(2)c(3)taac . cggccctaac
753 762 + test1: cg(2)c(3)taac . cggccctaac
293 302 + test2: cctagc(3)ta . cctagcccta
439 448 + test2: cctagc(3)ta . cctagcccta
469 478 + test2: cctagc(3)ta . cctagcccta
501 510 + test2: cctagc(3)ta . cctagcccta
801 810 + test2: cctagc(3)ta . cctagcccta
#---------------------------------------
#---------------------------------------
#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 13
#---------------------------------------
|
Output files for usage example 4
File: l46634.fuzznuc
########################################
# Program: fuzznuc
# Rundate: Fri 15 Jul 2011 12:00:00
# Commandline: fuzznuc
# -sequence tembl:L46634
# -pattern @../../data/nuc.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################
#=======================================
#
# Sequence: L46634 from: 1 to: 1272
# HitCount: 19
#
# Pattern_name Mismatch Pattern
# pat1 0 cggccctaaccctagcccta
# pat2 1 cg(2)c(3)taaccctagc(3)ta
# pat3 0 cggc(2,4)taac(2,5)
#
# Complement: No
#
#=======================================
Start End Strand Pattern Mismatch Sequence
429 448 + pat1: cggccctaaccctagcccta . cggccctaaccctagcccta
491 510 + pat1: cggccctaaccctagcccta . cggccctaaccctagcccta
429 448 + pat2: cg(2)c(3)taaccctagc(3)ta . cggccctaaccctagcccta
491 510 + pat2: cg(2)c(3)taaccctagc(3)ta . cggccctaaccctagcccta
535 554 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggccctaaccctaacccta
605 624 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggccctaaccctaacccta
631 650 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggccctaaccctaacccta
695 714 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggccctaaccctaacccta
721 740 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggccctaaccctaacccta
753 772 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggccctaaccctaacccta
791 810 + pat2: cg(2)c(3)taaccctagc(3)ta 1 cggcccgaaccctagcccta
753 764 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
721 732 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
695 706 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
631 642 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
605 616 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
535 546 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
491 502 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
429 440 + pat3: cggc(2,4)taac(2,5) . cggccctaaccc
#---------------------------------------
#---------------------------------------
#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 19
#---------------------------------------
|
Data files
None.Notes
None.References
None.Warnings
None.Diagnostic Error Messages
None.Exit status
It always exits with a status of 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| dreg | Regular expression search of nucleotide sequence(s) |
| fuzztran | Search for patterns in protein sequences (translated) |
Author(s)
Alan BleasbyEuropean Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
History
Written (2000) - Alan Bleasby'-usa' added (13 March 2001) - Gary Williams