|
|
eprimer32 |
Wiki
The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.Please help by correcting and extending the Wiki pages.
Function
Picks PCR primers and hybridization oligosDescription
eprimer32 is an interface to the 'primer3' program (2.x series) from the Whitehead Institute.The Whitehead program must be set up and on the path in order for eprimer32 to find and run it. The Whitehead executable must be renamed to primer32_core (or a link added) to avoid conflict with the eprimer3 application.
Primer3 picks primers for PCR reactions, considering as criteria:
- oligonucleotide melting temperature, size, GC content, and primer-dimer possibilities
- PCR product size
- positional constraints within the source sequence
- miscellaneous other constraints.
All of these criteria are user-specifiable as constraints.
eprimer32 can also pick hybridisation oligos that are internal to the product.
Advice for picking primers
We suggest referring to: Wojciech Rychlik, "Selection of Primers for Polymerase Chain Reaction" in BA White, Ed., "Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications", 1993, pp 31-40, Humana Press, Totowa NJCautions
Some of the most important issues in primer picking can be addressed only before using eprimer32. These are sequence quality (including making sure the sequence is not vector and not chimeric) and avoiding repetitive elements.Techniques for avoiding problems include a thorough understanding of possible vector contaminants and cloning artifacts coupled with database searches using blast, fasta, or other similarity searching program to screen for vector contaminants and possible repeats. Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase) is an excellent source of repeat sequences and pointers to the literature. eprimer32 now allows you to screen candidate oligos against a Mispriming Library (or a Mishyb Library in the case of internal oligos).
Sequence quality can be controlled by manual trace viewing and quality clipping or automatic quality clipping programs. Low- quality bases should be changed to N's or can be made part of Excluded Regions. The beginning of a sequencing read is often problematic because of primer peaks, and the end of the read often contains many low-quality or even meaningless called bases. Therefore when picking primers from single-pass sequence it is often best to use the INCLUDED_REGION parameter to ensure that eprimer32 chooses primers in the high quality region of the read.
In addition, eprimer32 takes as input a Sequence Quality list for use with those base calling programs
(e.g. Phred, Bass/Grace, Trout) that output this information.
What to do if eprimer32 cannot find a primers?
Try relaxing various parameters, including the self-complementarity parameters and max and min oligo melting temperatures. For example, for very A-T-rich regions you might have to increase maximum primer size or decrease minimum melting temperature. It is usually unwise to reduce the minimum primer size if your template is complex (e.g. a mammalian genome), since small primers are more likely to be non-specific. Make sure that there are adequate stretches of non-Ns in the regions in which you wish to pick primers. If necessary you can also allow an N in your primer and use an oligo mixture containing all four bases at that position.Try setting the '-explainflag' option.
Usage
Here is a sample session with eprimer32
% eprimer32 tembl:x65921 x65921.eprimer32 -explain Picks PCR primers and hybridization oligos |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Picks PCR primers and hybridization oligos
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqall The sequence from which to choose primers.
The sequence must be presented 5' to 3'
[-outfile] outfile [*.eprimer32] Whitehead primer3_core program
output file
Additional (Optional) qualifiers (* if not always prompted):
-[no]primer toggle [Y] Tell Eprimer32 to pick primer(s)
* -task menu [1] Tell Eprimer32 what task to perform.
Legal values are 1: 'Pick PCR primers', 2:
'Pick forward primer only', 3: 'Pick reverse
primer only', 4: 'No primers needed'.
(Values: 1 (Pick PCR primers); 2 (Pick
forward primer only); 3 (Pick reverse primer
only); 4 (No primers needed))
-hybridprobe toggle [N] An 'internal oligo' is intended to be
used as a hybridization probe (hyb probe) to
detect the PCR product after amplification.
* -mishyblibraryfile infile Similar to MISPRIMING-LIBRARY, except that
the event we seek to avoid is hybridization
of the internal oligo to sequences in this
library rather than priming from them.
The file must be in (a slightly restricted)
FASTA format (W. B. Pearson and D.J. Lipman,
PNAS 85:8 pp 2444-2448 [1988]); we briefly
discuss the organization of this file below.
If this parameter is specified then
Eprimer32 locally aligns each candidate
oligo against each library sequence and
rejects those primers for which the local
alignment score times a specified weight
(see below) exceeds
INTERNAL-OLIGO-MAX-MISHYB. (The maximum
value of the weight is arbitrarily set to
12.0.)
Each sequence entry in the FASTA-format file
must begin with an 'id line' that starts
with '>'. The contents of the id line is
'slightly restricted' in that Eprimer32
parses everything after any optional
asterisk ('*') as a floating point number to
use as the weight mentioned above. If the
id line contains no asterisk then the weight
defaults to 1.0. The alignment scoring
system used is the same as for calculating
complementarity among oligos (e.g.
SELF-ANY). The remainder of an entry
contains the sequence as lines following the
id line up until a line starting with '>'
or the end of the file. Whitespace and
newlines are ignored. Characters 'A', 'T',
'G', 'C', 'a', 't', 'g', 'c' are retained
and any other character is converted to 'N'
(with the consequence that any IUB / IUPAC
codes for ambiguous bases are converted to
'N'). There are no restrictions on line
length.
An empty value for this parameter indicates
that no library should be used.
-numreturn integer [5] The maximum number of primer pairs to
return. Primer pairs returned are sorted by
their 'quality', in other words by the value
of the objective function (where a lower
number indicates a better primer pair).
Caution: setting this parameter to a large
value will increase running time. (Integer 0
or more)
-includedregion range [(full sequence)] A sub-region of the given
sequence in which to pick primers. For
example, often the first dozen or so bases
of a sequence are vector, and should be
excluded from consideration. The value for
this parameter has the form
(start),(end)
where (start) is the index of the first base
to consider, and (end) is the last in the
primer-picking region.
-targetregion range [(full sequence)] If one or more Targets is
specified then a legal primer pair must
flank at least one of them. A Target might
be a simple sequence repeat site (for
example a CA repeat) or a single-base-pair
polymorphism. The value should be a
space-separated list of
(start),(end)
pairs where (start) is the index of the
first base of a Target, and (end) is the
last
E.g. 50,51 requires primers to surround the
2 bases at positions 50 and 51.
-excludedregion range [(full sequence)] Primer oligos may not
overlap any region specified in this tag.
The associated value must be a
space-separated list of
(start),(end)
pairs where (start) is the index of the
first base of the excluded region, and and
(end) is the last. This tag is useful for
tasks such as excluding regions of low
sequence quality or for excluding regions
containing repetitive elements such as ALUs
or LINEs.
E.g. 401,407 68,70 forbids selection of
primers in the 7 bases starting at 401 and
the 3 bases at 68.
-forwardinput string The sequence of a forward primer to check
and around which to design reverse primers
and optional internal oligos. Must be a
substring of SEQUENCE. (Any string)
-reverseinput string The sequence of a reverse primer to check
and around which to design forward primers
and optional internal oligos. Must be a
substring of the reverse strand of SEQUENCE.
(Any string)
* -gcclamp integer [0] Require the specified number of
consecutive Gs and Cs at the 3' end of both
the forward and reverse primer. (This
parameter has no effect on the internal
oligo if one is requested.) (Integer 0 or
more)
* -osize integer [20] Optimum length (in bases) of a primer
oligo. Eprimer32 will attempt to pick
primers close to this length. (Integer 0 or
more)
* -minsize integer [18] Minimum acceptable length of a primer.
Must be greater than 0 and less than or
equal to MAX-SIZE. (Integer 1 or more)
* -maxsize integer [27] Maximum acceptable length (in bases) of
a primer. Currently this parameter cannot
be larger than 35. This limit is governed by
the maximum oligo size for which
Eprimer32's melting-temperature is valid.
(Integer up to 35)
* -otm float [60.0] Optimum melting temperature(Celsius)
for a primer oligo. Eprimer32 will try to
pick primers with melting temperatures are
close to this temperature. The oligo melting
temperature formula in Eprimer32 is that
given in Rychlik, Spencer and Rhoads,
Nucleic Acids Research, vol 18, num 21, pp
6409-6412 and Breslauer, Frank, Bloecker and
Marky, Proc. Natl. Acad. Sci. USA, vol 83,
pp 3746-3750. Please refer to the former
paper for background discussion. (Any
numeric value)
* -mintm float [57.0] Minimum acceptable melting
temperature(Celsius) for a primer oligo.
(Any numeric value)
* -maxtm float [63.0] Maximum acceptable melting
temperature(Celsius) for a primer oligo.
(Any numeric value)
* -maxdifftm float [100.0] Maximum acceptable (unsigned)
difference between the melting temperatures
of the forward and reverse primers. (Any
numeric value)
* -ogcpercent float [50.0] Primer optimum GC percent. (Any
numeric value)
* -mingc float [20.0] Minimum allowable percentage of Gs
and Cs in any primer. (Any numeric value)
* -maxgc float [80.0] Maximum allowable percentage of Gs
and Cs in any primer generated by Primer.
(Any numeric value)
* -saltconc float [50.0] The millimolar concentration of salt
(usually KCl) in the PCR. Eprimer32 uses
this argument to calculate oligo melting
temperatures. (Any numeric value)
* -dnaconc float [50.0] The nanomolar concentration of
annealing oligos in the PCR. Eprimer32 uses
this argument to calculate oligo melting
temperatures. The default (50nM) works well
with the standard protocol used at the
Whitehead/MIT Center for Genome
Research--0.5 microliters of 20 micromolar
concentration for each primer oligo in a 20
microliter reaction with 10 nanograms
template, 0.025 units/microliter Taq
polymerase in 0.1 mM each dNTP, 1.5mM MgCl2,
50mM KCl, 10mM Tris-HCL (pH 9.3) using 35
cycles with an annealing temperature of 56
degrees Celsius. This parameter corresponds
to 'c' in Rychlik, Spencer and Rhoads'
equation (ii) (Nucleic Acids Research, vol
18, num 21) where a suitable value (for a
lower initial concentration of template) is
'empirically determined'. The value of this
parameter is less than the actual
concentration of oligos in the reaction
because it is the concentration of annealing
oligos, which in turn depends on the amount
of template (including PCR product) in a
given cycle. This concentration increases a
great deal during a PCR; fortunately PCR
seems quite robust for a variety of oligo
melting temperatures.
See ADVICE FOR PICKING PRIMERS. (Any numeric
value)
* -maxpolyx integer [5] The maximum allowable length of a
mononucleotide repeat in a primer, for
example AAAAAA. (Integer 0 or more)
* -psizeopt integer [200] The optimum size for the PCR product.
0 indicates that there is no optimum product
size. (Integer 0 or more)
* -prange range [100-300] The associated values specify the
lengths of the product that the user wants
the primers to create, and is a space
separated list of elements of the form
(x)-(y)
where an (x)-(y) pair is a legal range of
lengths for the product. For example, if one
wants PCR products to be between 100 to 150
bases (inclusive) then one would set this
parameter to 100-150. If one desires PCR
products in either the range from 100 to 150
bases or in the range from 200 to 250 bases
then one would set this parameter to
100-150 200-250.
Eprimer32 favours ranges to the left side of
the parameter string. Eprimer32 will return
legal primers pairs in the first range
regardless the value of the objective
function for these pairs. Only if there are
an insufficient number of primers in the
first range will Eprimer32 return primers in
a subsequent range.
* -ptmopt float [0.0] The optimum melting temperature for
the PCR product. 0 indicates that there is
no optimum temperature. (Any numeric value)
* -ptmmin float [-1000000.0] The minimum allowed melting
temperature of the amplicon. Please see the
documentation on the maximum melting
temperature of the product for details. (Any
numeric value)
* -ptmmax float [1000000.0] The maximum allowed melting
temperature of the amplicon. Product Tm is
calculated using the formula from Bolton and
McCarthy, PNAS 84:1390 (1962) as presented
in Sambrook, Fritsch and Maniatis, Molecular
Cloning, p 11.46 (1989, CSHL Press).
Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) -
600/length
Where [Na+} is the molar sodium
concentration, (%GC) is the percent of Gs
and Cs in the sequence, and length is the
length of the sequence.
A similar formula is used by the prime
primer selection program in GCG, which
instead uses 675.0/length in the last term
(after F. Baldino, Jr, M.-F. Chesselet, and
M.E. Lewis, Methods in Enzymology 168:766
(1989) eqn (1) on page 766 without the
mismatch and formamide terms). The formulas
here and in Baldino et al. assume Na+ rather
than K+. According to J.G. Wetmur, Critical
Reviews in BioChem. and Mol. Bio. 26:227
(1991) 50 mM K+ should be equivalent in
these formulae to .2 M Na+. Eprimer32 uses
the same salt concentration value for
calculating both the primer melting
temperature and the oligo melting
temperature. If you are planning to use the
PCR product for hybridization later this
behavior will not give you the Tm under
hybridization conditions. (Any numeric
value)
* -oexcludedregion range [(full sequence)] Middle oligos may not
overlap any region specified by this tag.
The associated value must be a
space-separated list of
(start),(end)
pairs, where (start) is the index of the
first base of an excluded region, and (end)
is the last. Often one would make Target
regions excluded regions for internal
oligos.
* -oligoinput string The sequence of an internal oligo to check
and around which to design forward and
reverse primers. Must be a substring of
SEQUENCE. (Any string)
* -osizeopt integer [20] Optimum length (in bases) of an
internal oligo. Eprimer32 will attempt to
pick primers close to this length. (Integer
0 or more)
* -ominsize integer [18] Minimum acceptable length of an
internal oligo. Must be greater than 0 and
less than or equal to
INTERNAL-OLIGO-MAX-SIZE. (Integer 0 or more)
* -omaxsize integer [27] Maximum acceptable length (in bases) of
an internal oligo. Currently this parameter
cannot be larger than 35. This limit is
governed by maximum oligo size for which
Eprimer32's melting-temperature is valid.
(Integer up to 35)
* -otmopt float [60.0] Optimum melting temperature (Celsius)
for an internal oligo. Eprimer32 will try
to pick oligos with melting temperatures
that are close to this temperature. The
oligo melting temperature formula in
Eprimer32 is that given in Rychlik, Spencer
and Rhoads, Nucleic Acids Research, vol 18,
num 21, pp 6409-6412 and Breslauer, Frank,
Bloecker and Marky, Proc. Natl. Acad. Sci.
USA, vol 83, pp 3746-3750. Please refer to
the former paper for background discussion.
(Any numeric value)
* -otmmin float [57.0] Minimum acceptable melting
temperature(Celsius) for an internal oligo.
(Any numeric value)
* -otmmax float [63.0] Maximum acceptable melting
temperature (Celsius) for an internal oligo.
(Any numeric value)
* -ogcopt float [50.0] Internal oligo optimum GC percent.
(Any numeric value)
* -ogcmin float [20.0] Minimum allowable percentage of Gs
and Cs in an internal oligo. (Any numeric
value)
* -ogcmax float [80.0] Maximum allowable percentage of Gs
and Cs in any internal oligo generated by
Primer. (Any numeric value)
* -osaltconc float [50.0] The millimolar concentration of salt
(usually KCl) in the hybridization.
Eprimer32 uses this argument to calculate
internal oligo melting temperatures. (Any
numeric value)
* -odnaconc float [50.0] The nanomolar concentration of
annealing internal oligo in the
hybridization. (Any numeric value)
* -oanyself float [12.00] The maximum allowable local
alignment score when testing an internal
oligo for (local) self-complementarity.
Local self-complementarity is taken to
predict the tendency of oligos to anneal to
themselves The scoring system gives 1.00 for
complementary bases, -0.25 for a match of
any base (or N) with an N, -1.00 for a
mismatch, and -2.00 for a gap. Only
single-base-pair gaps are allowed. For
example, the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but
the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative,
and a score of 0.00 indicates that there is
no reasonable local alignment between two
oligos. (Number up to 9999.990)
* -oendself float [12.00] The maximum allowable 3'-anchored
global alignment score when testing a single
oligo for self-complementarity.
The scoring system is as for the Maximum
Complementarity argument. In the examples
above the scores are 7.00 and 6.00
respectively. Scores are non-negative, and a
score of 0.00 indicates that there is no
reasonable 3'-anchored global alignment
between two oligos. In order to estimate
3'-anchored global alignments for candidate
oligos, Primer assumes that the sequence
from which to choose oligos is presented 5'
to 3'.
INTERNAL-OLIGO-SELF-END is meaningless when
applied to internal oligos used for
hybridization-based detection, since
primer-dimer will not occur. We recommend
that INTERNAL-OLIGO-SELF-END be set at least
as high as INTERNAL-OLIGO-SELF-ANY. (Number
up to 9999.990)
* -opolyxmax integer [5] The maximum allowable length of an
internal oligo mononucleotide repeat, for
example AAAAAA. (Integer 0 or more)
* -omishybmax float [12.0] Similar to MAX-MISPRIMING except that
this parameter applies to the similarity of
candidate internal oligos to the library
specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
(Number up to 9999.990)
Advanced (Unprompted) qualifiers:
-mispriminglibraryfile infile The name of a file containing a nucleotide
sequence library of sequences to avoid
amplifying (for example repetitive
sequences, or possibly the sequences of
genes in a gene family that should not be
amplified.) The file must be in (a slightly
restricted) FASTA format (W. B. Pearson and
D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]);
we briefly discuss the organization of this
file below. If this parameter is specified
then Eprimer32 locally aligns each candidate
primer against each library sequence and
rejects those primers for which the local
alignment score times a specified weight
(see below) exceeds MAX-MISPRIMING. (The
maximum value of the weight is arbitrarily
set to 100.0.)
Each sequence entry in the FASTA-format file
must begin with an 'id line' that starts
with '>'. The contents of the id line is
'slightly restricted' in that Eprimer32
parses everything after any optional
asterisk ('*') as a floating point number to
use as the weight mentioned above. If the
id line contains no asterisk then the weight
defaults to 1.0. The alignment scoring
system used is the same as for calculating
complementarity among oligos (e.g.
SELF-ANY). The remainder of an entry
contains the sequence as lines following the
id line up until a line starting with '>'
or the end of the file. Whitespace and
newlines are ignored. Characters 'A', 'T',
'G', 'C', 'a', 't', 'g', 'c' are retained
and any other character is converted to 'N'
(with the consequence that any IUB / IUPAC
codes for ambiguous bases are converted to
'N'). There are no restrictions on line
length.
An empty value for this parameter indicates
that no repeat library should be used.
-explainflag boolean [N] If this flag is true, produce
LEFT-EXPLAIN, RIGHT-EXPLAIN, and
INTERNAL-OLIGO-EXPLAIN output tags, which
are intended to provide information on the
number of oligos and primer pairs that
Eprimer32 examined, and statistics on the
number discarded for various reasons.
-fileflag boolean [N] If the associated value is true, then
Eprimer32 creates two output files for each
input SEQUENCE. File (sequence-id).for lists
all acceptable forward primers for
(sequence-id), and (sequence-id).rev lists
all acceptable reverse primers for
(sequence-id), where (sequence-id) is the
value of the SEQUENCE-ID tag (which must be
supplied). In addition, if the input tag
TASK is 1 or 4, Eprimer32 produces a file
(sequence-id).int, which lists all
acceptable internal oligos.
-firstbaseindex integer [1] This parameter is the index of the first
base in the input sequence. For input and
output using 1-based indexing (such as that
used in GenBank and to which many users are
accustomed) set this parameter to 1. For
input and output using 0-based indexing set
this parameter to 0. (This parameter also
affects the indexes in the contents of the
files produced when the primer file flag is
set.) (Any integer value)
-pickanyway boolean [N] If true pick a primer pair even if
LEFT-INPUT, RIGHT-INPUT, or
INTERNAL-OLIGO-INPUT violates specific
constraints.
-maxmispriming float [12.00] The maximum allowed weighted
similarity with any sequence in
MISPRIMING-LIBRARY. (Number up to 9999.990)
-pairmaxmispriming float [24.00] The maximum allowed sum of weighted
similarities of a primer pair (one
similarity for each primer) with any single
sequence in MISPRIMING-LIBRARY. (Number up
to 9999.990)
-numnsaccepted integer [0] Maximum number of unknown bases (N)
allowable in any primer. (Integer 0 or more)
-selfany float [8.00] The maximum allowable local alignment
score when testing a single primer for
(local) self-complementarity and the maximum
allowable local alignment score when
testing for complementarity between forward
and reverse primers. Local
self-complementarity is taken to predict the
tendency of primers to anneal to each other
without necessarily causing self-priming in
the PCR. The scoring system gives 1.00 for
complementary bases, -0.25 for a match of
any base (or N) with an N, -1.00 for a
mismatch, and -2.00 for a gap. Only
single-base-pair gaps are allowed. For
example, the alignment
5' ATCGNA 3'
...|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but
the alignment
5' ATCCGNA 3'
...|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative,
and a score of 0.00 indicates that there is
no reasonable local alignment between two
oligos. (Number from 0.000 to 9999.990)
-selfend float [3.00] The maximum allowable 3'-anchored
global alignment score when testing a single
primer for self-complementarity, and the
maximum allowable 3'-anchored global
alignment score when testing for
complementarity between forward and reverse
primers. The 3'-anchored global alignment
score is taken to predict the likelihood of
PCR-priming primer-dimers, for example
5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||
..........3' AAGTCCTACATTTAGCCTAGT 5'
or
5' AGGCTATGGGCCTCGCGA 3'
...............||||||
............3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum
Complementarity argument. In the examples
above the scores are 7.00 and 6.00
respectively. Scores are non-negative, and a
score of 0.00 indicates that there is no
reasonable 3'-anchored global alignment
between two oligos. In order to estimate
3'-anchored global alignments for candidate
primers and primer pairs, Primer assumes
that the sequence from which to choose
primers is presented 5' to 3'. It is
nonsensical to provide a larger value for
this parameter than for the Maximum (local)
Complementarity parameter because the score
of a local alignment will always be at least
as great as the score of a global
alignment. (Number 0.000 or more)
-scorrection menu [1] Specifies the salt correction formula
for the melting temperature calculation.
(Values: 0 (Schildkraut & Lifson); 1
(SantaLucia); 2 (Owczarzy et al))
-tmformula menu [1] Specifies details of melting temperature
calculation. (Values: 0 (Breslauer et al);
1 (SantaLucia))
-maxendstability float [9.0] The maximum stability for the five 3'
bases of a forward or reverse primer. Bigger
numbers mean more stable 3' ends. The value
is the maximum delta G for duplex
disruption for the five 3' bases as
calculated using the nearest neighbor
parameters published in Breslauer, Frank,
Bloecker and Marky, Proc. Natl. Acad. Sci.
USA, vol 83, pp 3746-3750. Eprimer32 uses a
completely permissive default value for
backward compatibility (which we may change
in the next release). Rychlik recommends a
maximum value of 9 (Wojciech Rychlik,
'Selection of Primers for Polymerase Chain
Reaction' in BA White, Ed., 'Methods in
Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and Applications', 1993, pp
31-40, Humana Press, Totowa NJ). (Number up
to 1000.000)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-sequence] (Parameter 1) |
seqall | The sequence from which to choose primers. The sequence must be presented 5' to 3' | Readable sequence(s) | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Whitehead primer3_core program output file | Output file | <*>.eprimer32 | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| -[no]primer | toggle | Tell Eprimer32 to pick primer(s) | Toggle value Yes/No | Yes | ||||||||
| -task | list | Tell Eprimer32 what task to perform. Legal values are 1: 'Pick PCR primers', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'No primers needed'. |
|
1 | ||||||||
| -hybridprobe | toggle | An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. | Toggle value Yes/No | No | ||||||||
| -mishyblibraryfile | infile | Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Eprimer32 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Eprimer32 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. | Input file | Required | ||||||||
| -numreturn | integer | The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. | Integer 0 or more | 5 | ||||||||
| -includedregion | range | A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region. | Sequence range | full sequence | ||||||||
| -targetregion | range | If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51. | Sequence range | full sequence | ||||||||
| -excludedregion | range | Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68. | Sequence range | full sequence | ||||||||
| -forwardinput | string | The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE. | Any string | |||||||||
| -reverseinput | string | The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE. | Any string | |||||||||
| -gcclamp | integer | Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.) | Integer 0 or more | 0 | ||||||||
| -osize | integer | Optimum length (in bases) of a primer oligo. Eprimer32 will attempt to pick primers close to this length. | Integer 0 or more | 20 | ||||||||
| -minsize | integer | Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE. | Integer 1 or more | 18 | ||||||||
| -maxsize | integer | Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which Eprimer32's melting-temperature is valid. | Integer up to 35 | 27 | ||||||||
| -otm | float | Optimum melting temperature(Celsius) for a primer oligo. Eprimer32 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. | Any numeric value | 60.0 | ||||||||
| -mintm | float | Minimum acceptable melting temperature(Celsius) for a primer oligo. | Any numeric value | 57.0 | ||||||||
| -maxtm | float | Maximum acceptable melting temperature(Celsius) for a primer oligo. | Any numeric value | 63.0 | ||||||||
| -maxdifftm | float | Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. | Any numeric value | 100.0 | ||||||||
| -ogcpercent | float | Primer optimum GC percent. | Any numeric value | 50.0 | ||||||||
| -mingc | float | Minimum allowable percentage of Gs and Cs in any primer. | Any numeric value | 20.0 | ||||||||
| -maxgc | float | Maximum allowable percentage of Gs and Cs in any primer generated by Primer. | Any numeric value | 80.0 | ||||||||
| -saltconc | float | The millimolar concentration of salt (usually KCl) in the PCR. Eprimer32 uses this argument to calculate oligo melting temperatures. | Any numeric value | 50.0 | ||||||||
| -dnaconc | float | The nanomolar concentration of annealing oligos in the PCR. Eprimer32 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. | Any numeric value | 50.0 | ||||||||
| -maxpolyx | integer | The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. | Integer 0 or more | 5 | ||||||||
| -psizeopt | integer | The optimum size for the PCR product. 0 indicates that there is no optimum product size. | Integer 0 or more | 200 | ||||||||
| -prange | range | The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. Eprimer32 favours ranges to the left side of the parameter string. Eprimer32 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will Eprimer32 return primers in a subsequent range. | Sequence range | 100-300 | ||||||||
| -ptmopt | float | The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. | Any numeric value | 0.0 | ||||||||
| -ptmmin | float | The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. | Any numeric value | -1000000.0 | ||||||||
| -ptmmax | float | The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG, which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. Eprimer32 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions. | Any numeric value | 1000000.0 | ||||||||
| -oexcludedregion | range | Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos. | Sequence range | full sequence | ||||||||
| -oligoinput | string | The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE. | Any string | |||||||||
| -osizeopt | integer | Optimum length (in bases) of an internal oligo. Eprimer32 will attempt to pick primers close to this length. | Integer 0 or more | 20 | ||||||||
| -ominsize | integer | Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. | Integer 0 or more | 18 | ||||||||
| -omaxsize | integer | Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Eprimer32's melting-temperature is valid. | Integer up to 35 | 27 | ||||||||
| -otmopt | float | Optimum melting temperature (Celsius) for an internal oligo. Eprimer32 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. | Any numeric value | 60.0 | ||||||||
| -otmmin | float | Minimum acceptable melting temperature(Celsius) for an internal oligo. | Any numeric value | 57.0 | ||||||||
| -otmmax | float | Maximum acceptable melting temperature (Celsius) for an internal oligo. | Any numeric value | 63.0 | ||||||||
| -ogcopt | float | Internal oligo optimum GC percent. | Any numeric value | 50.0 | ||||||||
| -ogcmin | float | Minimum allowable percentage of Gs and Cs in an internal oligo. | Any numeric value | 20.0 | ||||||||
| -ogcmax | float | Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer. | Any numeric value | 80.0 | ||||||||
| -osaltconc | float | The millimolar concentration of salt (usually KCl) in the hybridization. Eprimer32 uses this argument to calculate internal oligo melting temperatures. | Any numeric value | 50.0 | ||||||||
| -odnaconc | float | The nanomolar concentration of annealing internal oligo in the hybridization. | Any numeric value | 50.0 | ||||||||
| -oanyself | float | The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. | Number up to 9999.990 | 12.00 | ||||||||
| -oendself | float | The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY. | Number up to 9999.990 | 12.00 | ||||||||
| -opolyxmax | integer | The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA. | Integer 0 or more | 5 | ||||||||
| -omishybmax | float | Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY. | Number up to 9999.990 | 12.0 | ||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -mispriminglibraryfile | infile | The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Eprimer32 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Eprimer32 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no repeat library should be used. | Input file | Required | ||||||||
| -explainflag | boolean | If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Eprimer32 examined, and statistics on the number discarded for various reasons. | Boolean value Yes/No | No | ||||||||
| -fileflag | boolean | If the associated value is true, then Eprimer32 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, Eprimer32 produces a file (sequence-id).int, which lists all acceptable internal oligos. | Boolean value Yes/No | No | ||||||||
| -firstbaseindex | integer | This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) | Any integer value | 1 | ||||||||
| -pickanyway | boolean | If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. | Boolean value Yes/No | No | ||||||||
| -maxmispriming | float | The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY. | Number up to 9999.990 | 12.00 | ||||||||
| -pairmaxmispriming | float | The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY. | Number up to 9999.990 | 24.00 | ||||||||
| -numnsaccepted | integer | Maximum number of unknown bases (N) allowable in any primer. | Integer 0 or more | 0 | ||||||||
| -selfany | float | The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. | Number from 0.000 to 9999.990 | 8.00 | ||||||||
| -selfend | float | The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. | Number 0.000 or more | 3.00 | ||||||||
| -scorrection | list | Specifies the salt correction formula for the melting temperature calculation. |
|
1 | ||||||||
| -tmformula | list | Specifies details of melting temperature calculation. |
|
1 | ||||||||
| -maxendstability | float | The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Eprimer32 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). | Number up to 1000.000 | 9.0 | ||||||||
| Associated qualifiers | ||||||||||||
| "-sequence" associated seqall qualifiers | ||||||||||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 | ||||||||
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 | ||||||||
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||
| -sid1 -sid_sequence |
string | Entryname | Any string | |||||||||
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||
| -fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
| General qualifiers | ||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||
Input file format
eprimer32 reads one or more nucleotide sequences.
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
Input files for usage example
'tembl:x65921' is a sequence entry in the example nucleic acid database 'tembl'
Database entry: tembl:x65921
ID X65921; SV 1; linear; genomic DNA; STD; HUM; 2016 BP.
XX
AC X65921; S45242;
XX
DT 13-MAY-1992 (Rel. 31, Created)
DT 14-NOV-2006 (Rel. 89, Last updated, Version 7)
XX
DE H.sapiens fau 1 gene
XX
KW fau 1 gene.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC Homo.
XX
RN [1]
RP 1-2016
RA Kas K.;
RT ;
RL Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN [2]
RP 1-2016
RX DOI; 10.1016/0006-291X(92)91286-Y.
RX PUBMED; 1326960.
RA Kas K., Michiels L., Merregaert J.;
RT "Genomic structure and expression of the human fau gene: encoding the
RT ribosomal protein S30 fused to a ubiquitin-like protein";
RL Biochem. Biophys. Res. Commun. 187(2):927-933(1992).
XX
DR GDB; 191789.
DR GDB; 191790.
DR GDB; 354872.
DR GDB; 4590236.
XX
FH Key Location/Qualifiers
FH
FT source 1..2016
FT /organism="Homo sapiens"
FT /mol_type="genomic DNA"
FT /clone_lib="CML cosmid"
FT /clone="15.1"
FT /db_xref="taxon:9606"
FT mRNA join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT /gene="fau 1"
FT exon 408..504
FT /number=1
[Part of this file has been deleted for brevity]
FT RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT intron 857..950
FT /number=2
FT exon 951..1095
FT /number=3
FT intron 1096..1556
FT /number=3
FT exon 1557..1612
FT /number=4
FT intron 1613..1786
FT /number=4
FT exon 1787..>1912
FT /number=5
FT polyA_signal 1938..1943
XX
SQ Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac 60
ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac 120
tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt 180
agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta 240
gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg 300
tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag 360
gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca 420
cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc 480
gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg 540
tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg 600
tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc 660
cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct 720
ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa 780
tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac 840
ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct 900
tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag 960
cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg 1020
aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag 1080
gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag 1140
tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc 1200
tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg 1260
tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct 1320
ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt 1380
agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg 1440
ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt 1500
ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa 1560
agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga 1620
gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg 1680
ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag 1740
gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga 1800
gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt 1860
caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg 1920
taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt 1980
tacttgcaag gcctcaggga gaggtgtgct tctcgg 2016
//
|
Output file format
Output files for usage example
File: x65921.eprimer32
# EPRIMER32 RESULTS FOR X65921
# FORWARD PRIMER STATISTICS:
# considered 18855
# GC content failed 156
# low tm 9245
# high tm 3587
# high any compl 2
# high end compl 61
# long poly-x seq 45
# ok 5759
# REVERSE PRIMER STATISTICS:
# considered 18706
# GC content failed 161
# low tm 9106
# high tm 3606
# high any compl 3
# high end compl 25
# long poly-x seq 66
# ok 5739
# PRIMER PAIR STATISTICS:
# considered 4135
# unacceptable product size 3770
# high end compl 29
# ok 336
# Start Len Tm GC% Sequence
1 PRODUCT SIZE: 199
FORWARD PRIMER 201 20 59.90 65.00 ACCGGTTCTCCATCCCCGCA
REVERSE PRIMER 380 20 59.84 65.00 CCGCGCGGTTCCCTGCTATT
2 PRODUCT SIZE: 207
FORWARD PRIMER 826 20 60.04 70.00 GACCGGCCAGGAAACGGTCG
REVERSE PRIMER 1013 20 59.96 70.00 TGGCCTCATCCTCCAGGGGC
3 PRODUCT SIZE: 202
FORWARD PRIMER 831 20 60.32 70.00 GCCAGGAAACGGTCGCCCAG
REVERSE PRIMER 1013 20 59.96 70.00 TGGCCTCATCCTCCAGGGGC
4 PRODUCT SIZE: 205
FORWARD PRIMER 600 20 60.18 70.00 GTGGCCCTGCTCCAGTCCCT
REVERSE PRIMER 785 20 59.97 65.00 TGGGCGCGGACAAAGAGCTG
5 PRODUCT SIZE: 197
FORWARD PRIMER 203 20 59.84 70.00 CGGTTCTCCATCCCCGCAGC
REVERSE PRIMER 380 20 59.84 65.00 CCGCGCGGTTCCCTGCTATT
|
If the '-explain' flag has been used, as in the example, then statistics are output describing the number of primers that were considered and rejected for various reasons.
Headers describing the input file name and the names of the output columns are displayed.
The best 5 primer pairs are displayed with the product size.
The reverse sequence is displayed as the reverse complement to the input forward sense sequence.
The 'Start' positions are given counting from the start of the sequence for both the forward and reverse primer (and for the internal oligos).
Note that if you compare the results to the output from the public Primer3 web site you will see a difference in the reverse primer positions - this is because the original Primer3 program reports the reverse primer positions as counted from the 3' end. The convention in EMBOSS is to report both forward and reverse features as counted from the 5' end, so the reverse primer positions are given counted from the 5' start of the sequence.
Data files
None.Notes
The Whitehead Institute's primer3 program is not part of this program, but it must be set up on your system and on your path.
The Whitehead Institute program that is run by this program is available from:
http://primer3.sourceforge.net/
(Then see the link Download and then 'Release 1.1.4')
Earlier versions are also supported. We expect later versions to also work - please contact the EMBOSS team if you find any problems.
The Whitehead Institute's primer3 program states:
We request but do not require that use of this software be cited in
publications as:
Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386
Source code available at http://fokker.wi.mit.edu/primer3/. The paper above is available at http://jura.wi.mit.edu/rozen/papers/rozen-and-skaletsky-2000-primer3.pdf
References
None.Warnings
None.Diagnostic Error Messages
The message: "EMBOSS An error in eprimer32.c at line 346: The program 'primer32_core' must be on the path. It is part of the 'primer3' package, available from the Whitehead Institute. See: http://primer3.sourceforge.net/" is output if you do not have the Whitehead Institute's primer3 program set up and on your path. Note that compiling the primer3 package will produce an executable called primer3_core. This must be renamed to primer32_core (or a link of that name added) for eprimer32 to work. This is to avoid conflict with the primer3 version 1.x series primer3_core executables required by the EMBOOS application eprimer3.Exit status
It always exits with status 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| eprimer3 | Picks PCR primers and hybridization oligos |
| primersearch | Search DNA sequences for matches with primer pairs |
| stssearch | Search a DNA database for matches with a set of STS primers |
History
Author(s)
Gary Williams formerly at:MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.